|
ATCC
t5 caption a7 strain T5 Caption A7 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc03426712-247-19-66?v=ATCC Average 96 stars, based on 1 article reviews
t5 caption a7 strain - by Bioz Stars,
2026-07
96/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain genotype strain description bb120 atcc baa Caption A7 Strain Genotype Strain Description Bb120 Atcc Baa, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc05086544-100-22-29?v=ATCC Average 98 stars, based on 1 article reviews
caption a7 strain genotype strain description bb120 atcc baa - by Bioz Stars,
2026-07
98/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440 ![]() Caption A7 Recipient Strain Mobilization Frequency B Pnit6012 Pnit101 P Putida Kt2440, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc05165122-304-24-68?v=ATCC Average 94 stars, based on 1 article reviews
caption a7 recipient strain mobilization frequency b pnit6012 pnit101 p putida kt2440 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc ![]() Caption A7 Source Organism J Denitrificans Strain Atcc 14870 Dna Source Synthetic Dna Forward Primer 5 Ccgtagcaat Ggatcc Atgaagaagagaaagttgagagcgtcagc, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc04631597-97-20-27?v=ATCC Average 94 stars, based on 1 article reviews
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain mic ![]() Caption A7 Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc05740350-266-27-52?v=ATCC Average 94 stars, based on 1 article reviews
caption a7 strain mic - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 parental yeast strains genotype parent plasmid reference 972 wild type atcc ![]() Caption A7 Parental Yeast Strains Genotype Parent Plasmid Reference 972 Wild Type Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc04041700-246-22-33?v=ATCC Average 99 stars, based on 1 article reviews
caption a7 parental yeast strains genotype parent plasmid reference 972 wild type atcc - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc ![]() Caption A7 S Pneumoniae Strain Pae H Telithromycin Jnj 1 Jnj 2 Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc00538878-233-73-85?v=ATCC Average 90 stars, based on 1 article reviews
caption a7 s pneumoniae strain pae h telithromycin jnj 1 jnj 2 atcc - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 species strain mic ![]() Caption A7 Species Strain Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc00090018-140-30-48?v=ATCC Average 99 stars, based on 1 article reviews
caption a7 species strain mic - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 strain pae ![]() Caption A7 Strain Pae, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc00201171-107-28-46?v=ATCC Average 90 stars, based on 1 article reviews
caption a7 strain pae - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
ATCC
t5 caption a7 yeast strains kanb 3a 3b 3c 3d 3e 4c 4d pos itc flc c albicans atcc 10231 ![]() T5 Caption A7 Yeast Strains Kanb 3a 3b 3c 3d 3e 4c 4d Pos Itc Flc C Albicans Atcc 10231, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc05154386-149-33-51?v=ATCC Average 99 stars, based on 1 article reviews
t5 caption a7 yeast strains kanb 3a 3b 3c 3d 3e 4c 4d pos itc flc c albicans atcc 10231 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 mic ![]() Caption A7 Mic, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc07236257-92-92-123?v=ATCC Average 95 stars, based on 1 article reviews
caption a7 mic - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 c perfringens strain relevant characteristics source atcc 13124 type a strain ![]() Caption A7 C Perfringens Strain Relevant Characteristics Source Atcc 13124 Type A Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/caption+a7+strain+relevant+genotype+relevant+phenotypes/pmc02573335-109-26-34?v=ATCC Average 99 stars, based on 1 article reviews
caption a7 c perfringens strain relevant characteristics source atcc 13124 type a strain - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Deletion derivatives of the oriTN region and their mobilization. The numerals at both ends of each fragment are the nucleotide positions in the 430-bp oriTN region. Four predicted IRs with hairpin loop structures (see Fig. 1c) are indicated by different colored boxes, DRs are indicated by arrows, and the putative IHF-binding site is depicted as a red box. The frequencies of mobilization of pNIT101 to pNIT114 from G7(NAH7K3) to KT2400Gm are expressed by the numbers of the Tcr transconjugants per donor cell. Each frequency is the mean value obtained from at least three independent experiments. Statistical analysis was performed using the t test: statistical significance (P < 0.05) in comparison with pNIT101 (*) and with pNIT104 (**).
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Binding Assay, Comparison
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Conjugative transfer and mobilization of plasmids a
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation, Clone Assay
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Mobilization of oriT N -containing plasmid to various bacterial strains a
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Bacterial strains and plasmids used in this study
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Plasmid Preparation, Over Expression
Journal: Applied and Environmental Microbiology
Article Title: Host Range of the Conjugative Transfer System of IncP-9 Naphthalene-Catabolic Plasmid NAH7 and Characterization of Its oriT Region and Relaxase
doi: 10.1128/AEM.02359-16
Figure Lengend Snippet: Primers used in this study
Article Snippet: These results show that the NAH7 conjugation system has a broader host range than its replication system. table ft1 table-wrap mode="anchored" t5 TABLE 3
Techniques: Sequencing, Cloning, Amplification
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase
doi: 10.1107/S2053230X15019743
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Details of the cloning and protein-production procedures are summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Produced
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Antibacterial activities of erythromycin A, telithromycin, JNJ 1, and JNJ 2
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Inhibition of protein synthesis by erythromycin A, telithromycin, JNJ 1, JNJ 2, and ampicillin
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques: Inhibition
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: Decrease in bacterial counts of macrolide-susceptible and -resistant pneumococci after treatment with telithromycin, JNJ 1, or JNJ 2
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal:
Article Title: In Vitro Activities of Novel 2-Fluoro-Naphthyridine-Containing Ketolides
doi: 10.1128/AAC.49.1.309-315.2005
Figure Lengend Snippet: PAE of telithromycin, JNJ 1, and JNJ 2 on S. pneumoniae isolates
Article Snippet: PAEs for telithromycin, JNJ 1, and JNJ 2 were similar against the macrolide-susceptible and -resistant pneumococci (Table ), ranging from 3 to 4 h for the strain OC4409 (macrolide susceptible), to 5 to 6 h for strains OC4430 ( erm ) and OC4427 ( mef ), to 6 to 8 h for strains ATCC 6301 (macrolide susceptible), OC4444 ( erm ), and OC4568 ( mef ). table ft1 table-wrap mode="anchored" t5 TABLE 4.
Techniques:
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: MIC Values ( μ g/mL) a of KANA, KANB, 3a–e, and 4c, d against Various Gram-Positive and Gram-Negative Bacterial Strains
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques:
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: Bar graph displaying the relative initial rates of reactions of the various AMEs with KANB and its derivatives 3a–e and 4c, d. Rates are normalized to KANB.
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques:
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: MIC Values ( μ g/mL) Determined for KANB, Its Derivatives 3a–e and 4c, d, and Three Control Antifungal Agents (POS, ITC, and FLC) against Various Yeast Strains and Filamentous Fungi a
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques: Control
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: Representative time-kill studies of KANB derivatives 3c and 3d against azole-resistant C. albicans ATCC 64124 (strain B). (A) Cultures were exposed to 3c at 8 μg/mL (○), 16 μg/mL (▼), and 32 μg/mL (△). (B) Cultures were exposed to 3d at 2 μg/mL (○), 4 μg/mL (▼), and 8 μg/mL (△). In both panels, cultures were exposed to AmB at 1 μg/mL (■) or to a no drug control (●).
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques: Control
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: (A) Representative dose-dependent membrane permeabilization effects of KANB and its derivatives 3c and 3d on azole-resistant C. albicans ATCC 64124 (B). From top to bottom: Propidium iodine (PI) dye uptake by yeast cells without drug, with KANB (62.5 μg/mL), with 3c (1× and 2× MIC), and with 3d (1× and 2× MIC). (B) Quantitative representation of the images shown in panel A.
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques: Membrane
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: Hemolytic activity of KANB, gramicidin, amphotericin B (AmB), and 3a–e on mouse red blood cells.
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques: Activity Assay
Journal: Journal of medicinal chemistry
Article Title: Synthesis and Bioactivities of Kanamycin B-Derived Cationic Amphiphiles
doi: 10.1021/acs.jmedchem.5b01375
Figure Lengend Snippet: Mammalian cell cytotoxicity of KANB and its derivatives 3a–d against (A) A549 cell line and (B) BEAS-2B cell line.
Article Snippet: This is in agreement with our results showing that, as with bacteria, 3d may also be able to delay the development of resistance by fungi ( Figure S27 ). table ft1 table-wrap mode="anchored"
Techniques:
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Bacterial strains used in this study
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: Mutagenesis
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Appearances of biofilms formed by wild-type and mutant strains of C. perfringens on glass and plastic surfaces. The FE-SEM images show the relatively flat surfaces of biofilms formed by the wild-type (A), pilT mutant (C), and pilC mutant (E) strains. (A) The right side of the image shows the surface of the biofilm; in the center, the biofilm has been torn away, revealing a dense mixture of cells and matrix material. (C) The biofilm is present on the left side of the image, and the right side shows the glass surface used as a substrate for biofilm formation. (E) The entire surface shown is covered by a biofilm, with a crack in the surface visible on the right side. The material beneath the crack appears to be less thick and dense than the material under the surface of the biofilm formed by the wild-type strain shown in panel A. (B, D, and F) Laser confocal microscopy images of fluorescently labeled (Syto 9 and propidium iodide) wild-type (B), pilT mutant (D), and pilC mutant (F) bacteria. Representative images of quadruplicate samples are shown as single x-y sections. The white lines in each image indicate the locations of the z sections shown at the top or right edge of the corresponding figure. The thicknessesof the z sections shown at the edges correspond to the depths of the biofilms. Using compiled z sections, the thicknesses of the biofilms in panels B, D, and F were between 30 and 40 μm. Panels A, C, and E, bars = 10 μm; panels B, D, and F, bars = 20 μm.
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: Mutagenesis, Confocal Microscopy, Labeling, Bacteria
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Laser confocal microscopy image of a C. perfringens biofilm formed on a cooked meat pellet. The sample was incubated with BacLight Live/Dead stain and calcofluor white, which binds to polysaccharides. The white line delineates the extent of the biofilm formed on the pellet. The colors visible in the image correspond to the following materials: red, meat pellet; blue, polysaccharides (calcofluor white stained); green, live bacteria.
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: Confocal Microscopy, Incubation, Staining, Bacteria
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Localization of PilA in C. perfringens biofilms. (A) Three-day-old C. perfringens strain 13 biofilms were incubated with antibodies to either the C. perfringens PilA1 or PilA2 protein and then stained with Alexa Fluor 594-conjugated goat anti-rabbit antibodies. Images labeled as PilA1-control and PilA2-control were biofilms incubated with prebleed sera for PilA1 and PilA2, respectively. (B) High-magnification images showing differential interference contrast (DIC) and tetramethyl rhodamine isothiocyanate (TRITC) staining in biofilms. Antibodies directed against PilA proteins did not colocalize with bacteria.
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: Incubation, Staining, Labeling, Control, Bacteria
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Biofilm formation by multiple C. perfringens toxinotypes. (A) Biofilm formation in 24-well plates, measured as described in Materials and Methods. (B) Biofilm (A570)/planktonic-growth (OD600) ratio. White bars, 0 mM glucose; gray bars, 10 mM glucose; black bars, 100 mM glucose. In panel A, the P values shown represent a statistical comparison, using Student's t test, of biofilm formation between 0 mM and 100 mM glucose concentrations. For types C, D, and E, no statistically significant difference was found at these glucose concentrations. The error bars represent standard deviations.
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: Comparison
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Effects of glucose concentrations on biofilm formation in the wild type and a ccpA mutant strain of C. perfringens. (A and B) Biofilm formation by strains SM101 (wild type) (A) and SM120 (ccpA mutant) (B). (C and D) Ratio of biofilm/planktonic growth by strains SM101 (wild type) (C) and SM120 (ccpA mutant) (D). In panels A and B, the P values shown represent a statistical comparison, using Student's t test, of biofilm formation between 0 mM and 100 mM glucose concentrations. No statistically significant difference was found at these glucose concentrations for the wild-type strain at day 5 and the ccpA mutant strain at day 1. The error bars represent standard deviations.
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: Mutagenesis, Comparison
Journal:
Article Title: Type IV Pili and the CcpA Protein Are Needed for Maximal Biofilm Formation by the Gram-Positive Anaerobic Pathogen Clostridium perfringens
doi: 10.1128/IAI.00692-08
Figure Lengend Snippet: Biofilms provide protection against oxidative and antibiotic stresses. (A) C. perfringens 3-day-old cultures were separated into biofilm and planktonic fractions and then exposed to various oxidative stresses, as indicated. (B) C. perfringens 3-day-old cultures were separated into biofilm and planktonic fractions and then exposed to 20 μg/ml penicillin G (27 times the MIC [37]) for the times indicated. In panel A, the P values of differences in survival of biofilm versus planktonic cells were each <0.002, by Student's t test, under the conditions described for each experiment. In panel B, differences in survival of biofilm and planktonic cells at each time were compared using Student's t test. *, P = 0.0156; **, P = 0.0254. The error bars represent standard deviations.
Article Snippet: The standard culture conditions were incubation in a Coy anaerobic chamber (Coy Laboratory Products, Grass Lake, MI) at 37°C. table ft1 table-wrap mode="anchored" t5 TABLE 1.
Techniques: